circad | circRNAs associated with diseases

circRNA0003906
Gene	n/a	Organism	Human
Genome Locus	chr6:29989443-30003760:n/a	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	29123417
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	122 CRC tissues and matched nontumor tissues and Normal human colon epithelial cell line (NCM460) and six CRC cell lines (SW480, SW620, HCT8, HCT116, HT29, and LoVo)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCTGGCAGACCAGGGGTTAC Reverse TGCCTTGCCGCCATCTTTTA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Zhuo, F, Lin, H, Chen, Z, Huang, Z, Hu, J (2017). The expression profile and clinical significance of circRNA0003906 in colorectal cancer. Onco Targets Ther, 10:5187-5193.